ZFIN ID: ZDB-ALT-161003-17861
Genomic Feature: sa5935
Synonyms:
Affected Genomic Regions: sdk1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 11207264 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GTGGTGATTGTGGGTGAGGAGGAAAAGGAGGCAGAATGGAAGGTTTTATA
T/G
GAGAGAGACAGTCCTCCAGCCTCAGACACACTGGAGATTCCCAATCTCAT
(1)
OTHER sa5935 PAGES
ZMP:sa5935 (1)
GENOTYPESNo data available

CITATIONS  (1)