ZFIN ID: ZDB-ALT-161003-17807
Genomic Feature: sa5868
Synonyms:
Affected Genomic Regions: pcdh15a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 41172179 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AGTCTCACCATCGTCCCCTGTTATGATAATGCATGGCGGGCTGTCCTTGCCAACAGAAATTGTACTATACGAAAGCATGATGGTGCCCAGCAGTGGGTCGTCAGGATCCAAAGATGCGTAAGAGTCACGACTTTGCCTGGGGGTTCGATCAGCCAAAGCCTCAAACTGTCTGGCCTGTTCTCTGACTGATAGTTTTGTTTCAGTACTCCGACCACTTTGATCTGCATCAAGCTCCTCCCTGCTGTCTGTAAGCTCCGCCTTCAGCTGTTGCTCCTCCCACTGGGCCGGGTCCCAGAGAGCTTGTCTGCGCAGAGTACTGTAAAATCCTCGTCCTCGAATTCTGGATGGCAGTGACCATGAGGTGAATTGACCACAGGGGCTTGTTGGAGAAGGTGGGTCACTGTACAGAAAACCACTAATCCTTCGGACCTCCAAGTTAGGTTCCGGACTACTAGATAGGCCATCCTGGAAAATGGGATTTTGAGTAGTGAGTGGCCGTT
C/A
GTCTGACAGGAAGGTGATGGCGCTTTCTGATTTGGGAAGCTTGCTGCGCATCTGTCCGTTTCCAGTGGTCTGTTTGTGAGCAGCAATGGCACGCGAGGCGAAGTTTCGTATGAGGCTCTGTCTGTCCGCCTCCTCGATTACAGACCTTCTGCGTCTTCTGCAGACCACGAGAGAAAACCAAAAGGAGAGAGGAATGAAGCACGTGTGTGAAAAGAGATGGGAAGGAATTGAAGGAAGAGAACAGCCGTGGGAGCATAGCATGCTAATGAGCCACTACACAAAACAAATCCTTCACTTTAATGGACTTTGAAAGAGCTAAACCTAACAAATTTGCTTACGATATTAGACTTTGTACAAACTGAAGAATGTATTTGATAGTTGATGATTTTGCTAATACTTCAGGAGACTTTATTCTGCATTCAATTTAGTGCATTTTTAATGCCCTTCCGGGGACGTGCAAAACAGACATTAGTCAAAGTTCTCATATGGGGAACACTTTA
(1)
OTHER sa5868 PAGES
ZMP:sa5868 (1)
GENOTYPES No data available

CITATIONS  (1)