header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-17685
Genomic Feature: sa5588
Synonyms:
Affected Genomic Regions: grk3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 44170632 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAGGTGAAGGAGCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA
T/A
CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAA
(1)
OTHER sa5588 PAGES
ZMP:sa5588 (1)
GENOTYPES No data available

CITATIONS  (1)