ZFIN ID: ZDB-ALT-161003-17580
Genomic Feature: sa4537
Synonyms:
Affected Genomic Regions: lyst (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 49941486 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AACTTCTCCTTCTGCTCTTTCTGAGCGCGGCTGAAGTAGGCGTCCAGGAG
C/T
TACGGGAATACATGGACAGGTTTGTGTATCCAAGCATGACCGAGAGAAGA
(1)
OTHER sa4537 PAGES
ZMP:sa4537 (1)
GENOTYPESNo data available

CITATIONS  (1)