ZFIN ID: ZDB-ALT-161003-17095
Genomic Feature: sa41417
Synonyms:
Affected Genomic Regions: mlphb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 24012730 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTCAAGACTAAAATTATGAAAGAGGACAACAAGAGAGAGCTGCTGGAATA
T>A
CAGCCTAAACTCAGTGATTCACTCTGCATTCGCTGTCTCCAACCCTTCAA
(1)
OTHER sa41417 PAGES
ZMP:sa41417 (1)
GENOTYPESNo data available

CITATIONS  (1)