header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-15328
Genomic Feature: sa35935
Synonyms:
Affected Genomic Regions: c4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 32370880 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTGGATCAGTTTATCAATACCCTCCAGGTTTAAACAGTTGTCTATTGACT
C/A
GCCCATCACTCCACCTGAAACAGAGACAGCACTGACTGTATCTAAACTAT
(1)
OTHER sa35935 PAGES
ZMP:sa35935 (1)
GENOTYPES No data available

CITATIONS  (1)