ZFIN ID: ZDB-ALT-161003-14194
Genomic Feature: sa3123
Synonyms:
Affected Genomic Regions: amot (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 37514624 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGCAGCAAGGTCCAGTAAGCGGATACCCAGGGCCTGGCAGCCCAGCAGAC
G/T
AGCACTCGATGGTCCCACACATTGCGCGACAAGAGCCTCAGGGCCAGGAG
(1)
OTHER sa3123 PAGES
ZMP:sa3123 (1)
GENOTYPESNo data available

CITATIONS  (1)