ZFIN ID: ZDB-ALT-161003-13808
Genomic Feature: sa29545
Synonyms:
Affected Genomic Regions: whrna (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 13995625 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TTTAGTTTTGTGGACTACAACTGTTTTATTAGTTTAACCTTATTTTGTTCAAATTATTGCAAGTTGCTTTGGACAAACACATCTGGTAAAAGACTAAATGCACCAATACAGCTTTAAAAATGTACTCAAGAGAAAGTAAAAGTAAACATTTTTTAAAACTACTTAGTAAATTACGATTTCTGAGAAAAACTACTCAATTACAGTAATTTGAGTTTTTATAATTTGTTACTTTACACTACTGATTATAACTCAGGATCAAATCCTAGAAGTGGTTATGTTATCCTTGGAACCCAAAAAGAAAGTCAATAAATGATTAAATTTCCATATCTGTCTGAGTGATTCATTTAAAAATGAACATTCCCACTTTTTTTGCAGATAACGATTTTTTTCAGCATTGAATGGCTGAAAATAACTAGATGGGATAAAAACCGACAGCTGGTTAATGATTTATTAAACATCCAGCAGCTGCCGCACAATGCATCAGATCTGGCCAATTCTCA
C/T
CTCGAACCTGTGGCAGCGGCCGGACCTCGTTCACATCGGGCTCTGCGTTGGGCCTGTGCACCTCCACCATCACAAAATGCTGATTGGACGCTGGGGAGGAAGGGGTGGGTTTATCCGGGCAAGAGGGTGGAGGCAAAGGTGGAGGCGGAGGAGGAGGCGGACCGGGCGGAGCGGGTACATTCGGTGCAGGTGGAGGAATTGGAGATGAGGACTGAGCAGGCTTCGCTTTATTAGGAGACTGAACTCTTGGGAAAGGTCCGATTGGATGCTGACTCACGACTGAGAGCTGAGATGCCGGGACGTCTATTTTGAGGGTGCCAGGAGGAGACATGAAAGCTTTGGGTGCTTTAGGGTGTTTGGACTCTCTGGTGTGGGAACGAGAAGGAGCGGTGAAGTACAGGCCTGATTGGGAAGAGCTGGAAGAGGGACGTTTGCTAAGCGTGGCTTTTCGACTGGGACGCCGCTGGAGCCCTGGGGGAGGAGGAGGTTTAAAGGAAGGA
(1)
OTHER sa29545 PAGES
ZMP:sa29545 (1)
GENOTYPES No data available

CITATIONS  (1)