header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-13726
Genomic Feature: sa2930
Synonyms:
Affected Genomic Regions: mrpl35 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 43513092 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGAGGTACCAGTTCCTTCTTTTCCAGTAGGGTGACGTCATTTTGTCCAGC
A/T
ATTTACACTGAGTTTTGTTACAGAAAACATGTTCCCTCAGACGCTTCCTC
(1)
OTHER sa2930 PAGES
ZMP:sa2930 (1)
GENOTYPESNo data available

CITATIONS  (1)