ZFIN ID: ZDB-ALT-161003-13676
Genomic Feature: sa29152
Synonyms:
Affected Genomic Regions: daxx (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 7020819 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTCCTCTTCTTCTTCATCTTCCTTCTCTTTTTCTTCTTGCTCCTCCTTTT
C/A
TTTTTCTTTGCTTTCACTCTGTTGCCCATTAACAGCCTGTACAAAAAATA
(1)
OTHER sa29152 PAGES
ZMP:sa29152 (1)
GENOTYPESNo data available

CITATIONS  (1)