ZFIN ID: ZDB-ALT-161003-13675
Genomic Feature: sa29151
Synonyms:
Affected Genomic Regions: daxx (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 7020607 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Missense, Splice Site (1)
FLANKING SEQUENCE
ATCGTTGTCACTGATGTTAGCAGGCTCCTCTTCCACATCTTCTTCATCAT
C/T
TTCTGAAATTGGGAGAAATCAGGGTTAACTCAGTGAAATGAGGTGATTTC
(1)
OTHER sa29151 PAGES
ZMP:sa29151 (1)
GENOTYPESNo data available

CITATIONS  (1)