ZFIN ID: ZDB-ALT-161003-13650
Genomic Feature: sa2908
Synonyms:
Affected Genomic Regions: mpp5a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 34231513 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GACCAAGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAATGATG
G/A
TGAGTGTCTTCAGGCAAACATTAGAGTAAACTACACACCTTTAAAACATT
(1)
OTHER sa2908 PAGES
ZMP:sa2908 (1)
GENOTYPESNo data available

CITATIONS  (1)