header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-13575
Genomic Feature: sa28869
Synonyms:
Affected Genomic Regions: kdm1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 28100478 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
ATGCCTCCTGGTCCAGGAGGGTGCGGCAGAGGGGGTCCACCTGGTTCTCC
A/G
CTTGGGGAGGCTCTTTCTTTCTTTTTCACATCTGCTGAAATCGGGCCAGA
(1)
OTHER sa28869 PAGES
ZMP:sa28869 (1)
GENOTYPES No data available

CITATIONS  (1)