ZFIN ID: ZDB-ALT-161003-12985
Genomic Feature: sa26775
Synonyms:
Affected Genomic Regions: nasp (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 33914254 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
TTGGTTTCTCAGTTTTAGATGCAGTATCTGCTTCCTTTGGTGCTTCATCT
A/T
CCTTTACCTGCTTCTCATCTTCCTCTTTGTTGTTCCGTTCGCCTTCACCA
(1)
OTHER sa26775 PAGES
ZMP:sa26775 (1)
GENOTYPESNo data available

CITATIONS  (1)