ZFIN ID: ZDB-ALT-161003-12955
Genomic Feature: sa267
Synonyms:
Affected Genomic Regions: msna (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 22164021 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATATGAGACGCCGTAAACCAGACACCATCGAGGTCCAGCAGATGAAGGCA
C/T
AGGCCAAGGAGGAAAAGAACCACAAGAAGATGGAAAGGTGAAGAAACTGT
(1)
OTHER sa267 PAGES
ZMP:sa267 (1)
GENOTYPESNo data available

CITATIONS  (1)