ZFIN ID: ZDB-ALT-161003-12902
Genomic Feature: sa26510
Synonyms:
Affected Genomic Regions: rpl12 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 32882970 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
TTTGTGCTCTGGGCTCCAGAGCGCCGGGACTATAATAAACGATGAATGGG
T/G
AAAACTACTGAGCTTTATCTAACCGAACAATTTTAAACTTAATGTCTAAT
(1)
OTHER sa26510 PAGES
ZMP:sa26510 (1)
GENOTYPESNo data available

CITATIONS  (1)