ZFIN ID: ZDB-ALT-161003-12705
Genomic Feature: sa25972
Synonyms:
Affected Genomic Regions: polr2f (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 1515165 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACCAAATACGAGAGAGCGCGAGTGCTGGGAACACGAGCTCTGCAGATCGC
G/A
TGAGTGACTGATCCACAATCACCACTCAACACAACACACACACACACTGC
(1)
OTHER sa25972 PAGES
ZMP:sa25972 (1)
GENOTYPESNo data available

CITATIONS  (1)