ZFIN ID: ZDB-ALT-161003-12577
Genomic Feature: sa25537
Synonyms:
Affected Genomic Regions: dmd (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 11016431 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ACCCAACTGACATCAAAAATATAATGAGATATGGCCCCCCAAAACATATATTTTTGAATCACTATCATTGTTGTGCAGTTGCTTCTAACATCATTTGTGAATTTATTGCTTTGCATTGTACATTTGGAAGATAAAAGGTTCCTTTAAATATTAAAATATATAAAATATATTTATAATATATATATTTATAAAAGTATAAGTAAACAAATAGACCGAATGACATACTCAAATATCTGCAGATTTCTGCACACGTACATTGCATGCGGGGCCTATAAATTTGCATTTTACTGTATGTATATATCTATGTCTTCCAGACTCAACAACAAGTCTCTGGAAAATCCCTCCCTCATGTCCCTTCCTCTGCAAACCTATGGCACTTTTTGTCAATTTTATAGTCTGCCAAGGCAGTAAAAGTGTGGCACTGCTGATATCTATTAGAGGCTGTGTTATAGACACAGCTGCACTGCTTGGCAACATGGTGGAGCAGTCAACAGAAACAA
(1)
OTHER sa25537 PAGES
ZMP:sa25537 (1)
GENOTYPES No data available

CITATIONS  (1)