ZFIN ID: ZDB-ALT-161003-12527
Genomic Feature: sa25411
Synonyms:
Affected Genomic Regions: actr8 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 53519464 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GGAAACTGATGAACTAAATTGACCGTAGTGTATGAGTGTGCATGGGTTTTTCCCTGTACTGGGTTGCAGCTGGAAGGGCTCAGTGAAAAACACTAGCTGTGCATATTAACCCTTGTGTGACAGCACTATTTTTGACCCAACACCGCCTGTAGAGAAACGCTGCACAGGAGTGTGTGTTTGACGGCGCTATTTTTGACCCAGCAGAGGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTACCACAGGAGTCGATGCTGTGCAGGATGGCTTTATCGATGCCCAGAGCTTTTCCCTCAAACTGAGACATGGCTGTTTTCCTGGACAGCAGAGCAGACGGCGTCTCTTCAGTTTCAGCTCCTCCGACCAGACACTCGGCCTGAGAATGACCCAGATCCAGATCCTGACCCAGACTGCTCCTGTCTGACACCTCGCAAACGCTGGATTCACCTTCGAAACTGCTCGGTTTGGGGAAGGATTTACGATCTGCGCTGGCTTTAGAC
G/T
ACTAAAGAGAGAGAGAGAGGCAGATTAATGCTACTACAGTTTGATCAGAACAGATCTTTCAATTCCAGTTTCTTTGCAAATCCTGTCCTGTGGACACGTTTAGATGTAATACTATGGAGACATGTTAATACGCTGCTGTCAATCAACATCAGTGGGCGGGGAACACCCCACTGCTACATCATGTTGCAGTGAGCATCAAAATCTCTGGGATTTGGATCCTATTTTAACGTCAGGAAATAAAAACAGAGATTTATTGTGTTTCTATCACTCAAGTATGACTTGAGACTACACACACTACAGCGTACAAAGGTTGATTTTCATCATAGGAACCCTTTAAACATCATTAACTAGTAGAATAAGCTTACAGTAAAGTGCGACTGAAGCATTATTAATAGCTGTTCTCCATGTCTGAGAGTGAGTTATCTGCTGCACCTGGTCTTGTTTGCTCTGTGTGGTCAGCAGAAAGTGTTCGTCGTGAGGATCCTCCGCGTCTCCCTGAG
(1)
OTHER sa25411 PAGES
ZMP:sa25411 (1)
GENOTYPES No data available

CITATIONS  (1)