ZFIN ID: ZDB-ALT-161003-12484
Genomic Feature: sa25350
Synonyms:
Affected Genomic Regions: si:dkey-28d5.3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 4779007 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
CTTGAAATGGTAATTGCAGTAAAATCTATAATCAACATGAACTCATAACAACTCAACTCTTCATAACATTTTTTTTCTTAAACTTCAGTGCTGTTTCTGTTCACAACCAGAGCATACAGCAGAGTAAGATTAAACTGATAATGTTATGTTTTAATTGATTTTATTAAAGTGAGCAGAGGACTGGTATTTGTCAATCAGGAGATGAACTGGAGAGACGCTCAGAGCTACTGCAGACAGAATCACATTGATCTGGTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGATGTTCATTAATGACAGAAATTCAGCAGCCTGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGATCAGAGCAACTCCTCATTCAGATACTGGGCCCCTAATAATCCAAAAGTTGCATACAACGCAGTGATTGAACCGAAAACATTGGGACAATGGGGTGACTACTTTAGTCCTTACCATCAGTATCCTTTTATATGTCATGAAGG
T/C
GAGCAGATCCTCCAAACACACTCAATCCATCATCAGCTCCAGATCTCTAAAAGTTGACTCTACATGTCTGACATGACAAATTCCTCCACAGTGTTTGTTCTGCATGTTGTTGTTGATCAGTCTCTCTCTAGTTTCTGCTTTGTTTTGTGTCCAGATAAACTGATTGTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGCGTCGTGTGATGAACGTGGTTAAACTGGCTTCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTGCGCTTTGGGCATCTGGTTCTGGGTGAGTGGAGAGACCGTGTGCTATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGGAGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTCTGGAGGAAATCAGACCTGGATCAGCCGTCCTGAAACTGACCGACTCAACTTCAT
(1)
OTHER sa25350 PAGES
ZMP:sa25350 (1)
GENOTYPES No data available

CITATIONS  (1)