ZFIN ID: ZDB-ALT-161003-12122
Genomic Feature: sa24951
Synonyms:
Affected Genomic Regions: gnpda2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 4276859 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AGCGCACATGACCGGAACCCGATCACATGACCAGTGTTTTCAAAGAAAACTTGCACCCATTCACCCAACCCGCTCGTGGCTGAGATCCTGCGTTTTATTACAGTAAGTGAACGATTTTATTACTCATTATACATGCAGAATCACTGCTCGACGTCTTCGAGTGTTTATGAACGCGGCAGGCTGTAAATAATGCAGTTCCGTTTCATGTTATTTGATGTCAGCTCATAAACAAACAGTGAGATGATTGTATGTGATTATGTGCTGTAACGTTACGTGTTATTTGAGCATATTTATTAAAGTAAATGTGCATTTTCTGCTCCTTTCTGGATTTGGCATGGTCAGAGTTGTTCAATAAAGTATTGGCATGTCTTTATTTTTAGTCTTCAGGCTGCACGGTGTCCTGCTATCAGTGAAAAGTCATGAGACTTGTGATTCTGGATGACTATGATCTGGCCAGCGAATGGGCTGCAAAGTACATCCGCAACCGGATCATCCAGTTC
A/T
AACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTAAATTGAACGTGTAAAGTCAGCATTTTACCCTGCTTTGTTAGGAAAGTGAACACGAAAGCTACATTTACTTTACAAATACACTTTATTTTGCTTTTTAAGGCATCCCAAATAAAAAAAAACATACTTTTTTTTCTAGTATTTACTATAATAATTTCAAATATTTACTATGATCATTTAAAGTAAACATTAGAATGTTTTTGAACAATATTAGATTACAGTACTTGAATTAATCTGTTGTGGAAATTTTATTATACAATAGTTTTCTACAACTACTTTATATATATTACAGTACACCACAGTTTACTGTAGTAAAAACTAAAGTATACGACAGGATTTATTATGGTTTATCAGTTCACTTTAGTTAATACTACAGTATTCCTTATCATTCATTGAAAAAAAGAGTTGTAAATACTTTACACAGTATACTACACTTTACTATGGTGTAAAAGTACTAT
(1)
OTHER sa24951 PAGES
ZMP:sa24951 (1)
GENOTYPES No data available

CITATIONS  (1)