ZFIN ID: ZDB-ALT-161003-12014
Genomic Feature: sa24835
Synonyms:
Affected Genomic Regions: sdk1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 11206709 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AATGTTGTTTTCGTTCTCGTTCTCTCCTCTTTTATATGGCTTCTAGGTTC
A/T
GAATGAAGCAGGTGAACATTGTTGGTTCGAGCCCCTTTAGTGAGTCCTCC
(1)
OTHER sa24835 PAGES
ZMP:sa24835 (1)
GENOTYPESNo data available

CITATIONS  (1)