header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-11619
Genomic Feature: sa2314
Synonyms:
Affected Genomic Regions: ak4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 31355738 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GGGAGGCACTGATTCAGCAGGAGGATGACAGACCAGAAGCCCTGGTGGCC
A/T
GACTGAGACACTACAAAGATGTTGCCAAACCTGTCATAGACTTCTATAAG
(1)
OTHER sa2314 PAGES
ZMP:sa2314 (1)
GENOTYPES No data available

CITATIONS  (1)