ZFIN ID: ZDB-ALT-161003-11453
Genomic Feature: sa2250
Synonyms:
Affected Genomic Regions: git2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 19915556 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGAAAGGGAACACTCCGCTGCACATCGCGGCTAAAGCAGGTCAAGTGTGC
C/T
AGGCTGAGCTTCTTTGCGTTTATGGGGCAGATCCTGGAGCTCCAGACTCC
(1)
OTHER sa2250 PAGES
ZMP:sa2250 (1)
GENOTYPESNo data available

CITATIONS  (1)