ZFIN ID: ZDB-ALT-161003-11368
Genomic Feature: sa22208
Synonyms:
Affected Genomic Regions: dld (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 6076590 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AAAATGCGAGCCTCTCGATTCCGACTCAGAGGAGAAGCACAGAAATCATT
T/G
AAAAAGGTAAATGAGTGTGAATTTTGGCTAGCGCAGATCCATTTGTCGAT
(1)
OTHER sa22208 PAGES
ZMP:sa22208 (1)
GENOTYPESNo data available

CITATIONS  (1)