ZFIN ID: ZDB-ALT-161003-10950
Genomic Feature: sa2047
Synonyms:
Affected Genomic Regions: ptprfb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 17728315 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TTCCTAATCATGCCGACAAAAAAATTTAAAAAGCAACTTTTTTTTTCTTCAGTCTTACTTCAAAATTTATTGTCAATCTTTAATTATAAAAAAAAATTCTAAGTAATTTTGAGCAGATGCTAATGGTCTAATCTGATTCAATGATCTATGCTAAGCTAGGCTAAACTTGCTCCCCCCTGATCTGGTGATAAACTGAATGGATTAAAAAATGGCAAAACTAAACTGTTTAACTCCAGGCTATTGTCAAAACAAAGGTGTTCCAGCAATAGAGTGGATATTGTTCCAGTGATTGTAGGGATGTAAGAAAGTCTACCTGAGCGAAGCTGTTTGATTCGCCCGTTGCCGTTGATGTCTACAGGCAGGAAGTCTTTAAACCAAGTGATCTCCGGGTCAGGGTTCCCACTGGCAGCACAGAGCATTGTAGTTGTTCTTGTTCGCTCCACCACTTTCAGCTGAGGACCCATGTCTATGGTGGGGAAACCATGCGGAATCTGATTTTC
T/A
GCAGAAAGAAAGAAAGAAAAAAGCAGGTCAAGTCAGGAGCCTAAAGGAGCACCATTTACTTAATAAGGGTAATGATCTTAAAGAACCCTGATTGCTGTGAATCAAGGGTTAGAGATGCAAGCCAGGCGTAATTGTCCTGCAAAAGCAAATCCAGGAGAAGTCTCATTAGAGCACTAAATCAATTCACTTCCCAGAAAAAAGGCCTCCCTGTGCATTATTAAGATCAAAGCGTGGCAAGGCTAATCCACTGGATGTTTGTGTATACCGTTATGCTAACATGTAACACCATATGGACTGCAAGCTTTAAGTTTTAAGCTGCAAGCTTTCAGTTTGATCTGGATCTTTACAGGAGTTTGAGTACAAACACAGACAGGGCAAAAACAATGACATTATGAATAAAGCCAACCATGAGAGGAGCAAAGAATACATTGAACTTGCTAAATGTTATCAAAGGAGCGGTACATTGAGCTTCCTCATACTTGCTACACCTTTTCCTACAT
(1)
OTHER sa2047 PAGES
ZMP:sa2047 (1)
GENOTYPES No data available

CITATIONS  (1)