ZFIN ID: ZDB-ALT-161003-10424
Genomic Feature: sa18882
Synonyms:
Affected Genomic Regions: c6ast4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 38636360 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TCTGAGTGGACTTGCCCAGCTCAGCGTTATTGTTGGGAATGGGAATCATAGTGGGATATCCGTTCTTGGAGAAAGCATACCTGAAAGCAAGTGACAGTTAGATTACAATCTGGGAGACTTTTGAAAAAAGTTAATCTTGAGCTCACCCACCTCTCGTACTGCATCACAGACTTGTAGTCATAAGGAGTTCCCTGGTTCAGGGTGTTGATTTTATTGAAGTTGTACTTCATGTCTGATGAGAAAACAAAACACATCCAAATCAGTAAACACACTACATAAGAGTATGGGCTCTCCTCAAAGTGTTCTGTGACTGAACATTACCATCAAGGATGTTCTCCCAGATGACCTGGATGTGATTGTCACGGTCACTGCGGGTTTGTTCATGGTTGAAGCCCAGGGCGTGGAGCAGCTCATGCTGAACAGTGCTGTGGTAAAGACAGCCACTTCGGGCCAGAGATACTGTCTGGACATTACCCTGACGGCCAACGTAAGAGTAGCAC
C/A
TGTAAGATGAACATAATGTCAACATTTATGTGTCACACAGACATTGATATGTTAATGTTTCTCAATAATATTGAAAATAAATGAAAACAGTTCTCATTTCTTGTCATCATTACTGTGAAACATTGTTGGAATATCAAGCCAACTCCATGCGTGTTCAAGAGAAAAGGTCAGGAGAGGTTTTTCTTCAATGACAAAAATATTAGTAATTTATTGGATACAAATGAATAATTCGATGACAGAGCTCTGGGTTACATTACCCCAATGCAATACGAGAATTACATTCAAGAGGTTCGCAACTAACATACATTTCCTGACTTCAGCATATATACACCACCGATCTTAACAGGTGGAGTTTTGGTGTAACGTCACTTGTCAGTCATTGTTCAGTCCTCCATTGGCCGCACCTTCGACATACTTCCTCTTTTTCTACGAATTCTCTGCCCAACAACAAAGTATACATCTTTCTATGTTCTGTGTTCAGTTTTAACACCTCTCTTCAG
(1)
OTHER sa18882 PAGES
ZMP:sa18882 (1)
GENOTYPES No data available

CITATIONS  (1)