ZFIN ID: ZDB-ALT-161003-10392
Genomic Feature: sa18814
Synonyms:
Affected Genomic Regions: si:dkey-193c22.1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 40203260 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GGAAACCTGAGCACCTGGAGGAAACACGGACAGATCAAGCAAACTCCACCAAAATGCCAACTAAACCAGGTGGGGCTCGTACAGTACCAGCGACCTTCTTGCTTTGAGGCGAGTACTTACACACACACACACACACACACACACACTGAAAATGTCCTTGGTCTGTTAAACATCACATCTCAAAGAATTCAAATTTCACAGGAGAACTAATTTTGTTGTAAATTGTACAAAAAATAAGAACTTATTTAAATGATTTTCTATAGCAATACATACAATACAAATTAATGTATTGTTTCTACAGGATTTGAACCATTGTGTGAACTTAGTTTGTGTAACTATTGTGTTAAATAAGTAATAATAACAATGTTATACCGTTTCAACTGATCCTCCTTCATTTTCTTGAGTAATGAGGTTGGTGAGTAATAATCAAAGTTCTCCACACCATCCATGGCTTTATGCATAGTTGACACGTATTCAACAGCCCGCACTTTCTCATGGTT
A/C
TAATGATCCATTATGCTGTAAACTCCACTCAGACCTATTACAAAAGCAAAAACATAATAAGAAGCAAAGCCTTTGTTATGCCAGCTACATGCTGATTCTTAATACAAAAAGTAAAATCTAAATACATTATACTCATGTTTTATTTCTATAGTGCTTTTACAATGTAGATGTCGAAGCAGCTTGACAGAAGTTCTAGTAAACAGTTTTAAATACAGTATGTGGTGCACTGATTTACCGATGATTCCTTTAATGGCAGTGACCAAATCTTTCTGTTTGTTGGTCTCAATGAAGAGCTCTTCTACATTGCTGGCCAGAAACAGTGAGGTGAGGGCACACAGATGAGCCCCTGCTGAATGACCGATTAATATTATGTTGTCCTGCGTAAATAAAATGAAAAGGTGTAGGTCTGCATCAATTTAGCCTTGGAGAAACTGATTAACGATGGACGCACACACTCAAAAATTGACATTTGCTATTTGTTTAAACTACTTATTTAAAAT
(1)
OTHER sa18814 PAGES
ZMP:sa18814 (1)
GENOTYPES No data available

CITATIONS  (1)