header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-160323-5
Genomic Feature: y447
Synonyms: lnx2aD329 (1), lnx2aΔ329 (1)
Affected Genomic Regions: lnx2a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-lnx2a
Lab Of Origin: Dawid Lab
Location: Chr 24: 21671085 - 21671346 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: in Donor Splice Site of Exon 2 (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GCTATTTATATTCTCCTGGATTTATTATAAATATGGAGGTGTTTGTATCTGAATTTTATTAAGCACACTTTATACACATAGCTAGGCCTGTATATAAGGTTTATTGGTGCTGTTAAATTAATTATCACGTTCAAAAAAAAAAGTTTGTACACATGGATGTATTGATTAAATGTTGATAACATGCCTCCTTTTCTTCTGCTTTTCAGACATTTTCATAAACTTTCCCCCCTTTTTGACTTTTTGAGCAAAAAATTTTGGCAGTCTATAAAAAGCTGTTCGCCATTTCTTATTTTGGCCAATCTAAACAATTATAAACAACATAAAATATACACATTTTGATGTTCTGATTGCAGTTCCTATGTAAAAGAACCACTTCCTGCCCTCTATCTGAATTTCATGCAACATCAATGGCATCAGATAAAAATAACCTAATGCTCGAGTACCAAAACATTGACATCAAATAGTGCTTATTTGAGTCTGAATATTTGTCTTGAGAACTT
TACCTGTGTTTGAGATGTGCCTCCAGGTCGCAGCGAGGCATGCTGAGCGAGCAGGAGGGCGTGAGCGGACAGGTGACCGACAACTTGTCCAGCAGCTTGTGCACCAGAATGCTGGAGCGCCGGCAGACCTGCAGCTGCAGATGCGCACGGTCCAGTGGACAGAAGTCCCGTTCCTGCAGGAAGCTGCGCAGACAGCGGGCACAGAAGGTGTGGCCACATGGTGTATCCAGGGGCTGAACTAACGGCTGAAGGCAGATGTGGC/-
ACACCAAATCATCATCCACTTCCAAACGATAGTTATAAAGGTGGTTCTCCCAGGTGCGGTGAATCTGTCCACATTCAGAGCAAAGGGCCTCCAGAAGAGCTTCGCTCACCATGCCCGGGTCCACTCCCTCTCCCAGACTGCCCATTGCTCTCGGCTTTGGCTACACTCACTCAGTCCATCCCGCGGGCGTCAGAGGCTGTGCGACTCCGGCAGGGGACGACCACCCCCTGGCAGGCACAGTGACATCACTCTGAAGGGTGGCAGAGAAACAGTGAGGTAACTATTGTGAATGAGAGACAGTGTTTGTGTGTGCCAGGATGAGATTATGTTGCAGAGCAGTGTGGGTTTACTCCTGCACATTAATCTGGCAGTGTAATCTCATGCTCTCTCGCCTAGAGAAATCTTTCAATCCCGCAGAGAGAGAATTATCCAGGATTGAGGCAGGGAGCACCGAGTCAAGAGGTTTTCATGTGAAAGTGAGAAAAGGAGGGGCAAGAGAA
NOTES
Comment Citation
The exon 2 splice donor site has been lost resulting in a truncated protein. ZFIN Staff
OTHER y447 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous lnx2ay447/y447 lnx2a ♀-/- ♂-/-
lnx2ay447/y447 lnx2a ♀+/- ♂-/-
lnx2ay447/y447 lnx2a ♀+/- ♂+/-

CITATIONS  (2)