header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-140917-8
Genomic Feature: um195
Synonyms:
Affected Genomic Regions: hoxb1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Sagerström Lab
Location: Chr 12: 27141734 - 27141741 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted in Exon 1 (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TAGACCTACATAGCGACTTTATCAGATTGACGGGTGGATTCGATTGATGTGTTTGTCATGTAAATACGAATCGTTTGATGGACACCTGCAACGCCCAGAGTGCTACCGCAGGTCGCACACTATTGGCGCAAAATTAGTCACATGATCTGTCACTTAACTGATATGAGCTCAGATACAACTTTGCGTGGTTTGACATACTGCTTAGAGGTTGTAGGGGCACTGGGACCACACATCAGCTCATATTGACCCTGCTTAATCAATTTTGCTTGGTCAGTCAACAATGAATTCTTACTTAGATTATACGATTTATAACCGTGGTTCTAACACTTATAGTTCGAAAGTTGGGTGTTTTCCTGTAGAGCAAGAATACTTGCCAAGTGCTTGTGCAAGTACAAATAGTTACATTCCCGAGGGACGGCCAGTCGGAGGAAACACTTTCACATCGGCACCGCACGAAACTCATGGCACATCTTACGCACAAATTCAATCGCAGCCCTTCC
ACCTCAAC/-
GTGGACATGGGTAAAACAGGACACAGCAATTTCTGCAAGCAAACCAGACCTCCTCATTCGGACTATGGACATCAACACGTTCTCACTCAAGCAGATGACCACATGCGCCTTCAGTCCCCTGGCTTTTCCGTCGTGAATATGGGAGCCAATATTGGAACTTACAGTGAATCAAACTGCAGGCCTGGCTCGGTCTCTGCAAGCCACTATCAATCATATGCATATGGAGAACCCGAACCACACGGCTATGGTTCGTTCAGCAAGTATCAGGTCTCCCCTGACAGTGACAGCGACTCCAAGACGAACATTAAACAAGCGCCAACCTTTGACTGGATGAAAGTCAAGAGGAATCCCCCTAAAACAGGTGAGTTATGACTAGTTACAATGGCTATAGATAATGTGATATTAAAATACAGTTTCTAAGTCGTGTTTTTATTCAATGCTAATTTTCAGTTAAAGTCGCCGAATACGGAATCCATGGCCAGCAGAACATAATACGCACC
NOTES
Comment Citation
Weicksel et al, 2014: Deletion (−8 bp) in exon1 of hoxb1b Weicksel et al., 2014
OTHER um195 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hoxb1bum195/um195 hoxb1b ♀+/- ♂+/-

CITATIONS  (2)