Genomic Feature

sa22954

ID
ZDB-ALT-131220-368
Name
sa22954
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 16: 49093568 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
ATATGAACCAACCTCTTTCTCACTATTACATAAACTCTTCCCACAATACCTACCTGATTGAGGATCAGTTCAGGGGTCCGTCAGACATTACGGGTTACATCCGTGCCCTAAAGATGGGTTGCAGGAGTGTAGAACTTGACGTGTGGGATGGACCAGATAATGAACCAGTCATTTACACAGGCCACACAATGACCTCGCAGATTGTTTTCCGCAACGTCATTGACATCATCAACAAGTATGCATTTGCGGCCTCAGAATTCCCTCTATTCCTTTGCTTGGAAAATCACTGCTCTTTGAAGCAACAGAAGGTAATATTTCAACACCTGAAGAAAATACTAGGAGATAAAGTCCATACAGATCCACCCAACCTGGAGGACAACTATCTTCCATCCCCTTTGGATTTAAAGGGAAAGATTCTTCTAAAAGGAAAGAAACTACCGAGCAACTGCACTGAACCTGAGGGCGAGGTGACTGATGAGGACGAAGGTGCGGAAATGTCC
C/T AACGAATGAACAACGAGGCTAGTGAACAACAAGTTGTCGTTCAACCCAAAAAGTTCCAGCTTTCCAAGGATCTGTCTGACTTGGTAACGTTATGCAAGTCTGTTCAATTTAAGGACTTTCAGATGGCTTTCCAGAACCAGAAGCACTGGGAGCTTTGCTCCTTCAATGAGGTCTTTGCTAGTCGGTGTGCCACGGACCACCCTGGAGACTTTGTTAATTACAACAAGAAATTTTTAGCAAGGGTTTACCCAAGTCCAATGCGAATTGATTCCAGCAACATGAACCCGCAGGACTTTTGGAAATGTGGCTGTCAGATTGTAGCAATGAACTATCAAACGCCAGGTCTCATGATGGACCTCAACATTGGCTGGTTTAGACAAAACGGGAATTGTGGCTATGTACTCCGTCCGGCTATCATGAGGGAGCAGGTGTCTTATTTCAGTGCCAATACTAAAGACTCAGTTCCAGGAGTTTCTCCGCAGCTCCTTCACATAAAGATC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations