ZFIN ID: ZDB-ALT-131217-14709
Genomic Feature: sa19449
Synonyms:
Affected Genomic Regions: ank2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 14152431 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GTCTACATTTTAAATGTCAACACAGTGTAAAGAACCAGCAACTATTCCAGCATATGTTTTACACAGCGGATGCCCTTCCAGCCGTAGCCCAGTACTAGAAAACAACCTTACACACTCACTCACACACTCATACACTATGACCAATTTAGTTAATAGAATTCACCCATGGCACATATCTTTGGACTGTGGGGGAAAGCAGAGCAAACACACCGAAAAAAAACACACAAACACAGAAAGAACATGCCAACTGGCCCAGCTGGGACTCGAAACGGCAACCTTCTTGCTGTGTGAGGTGGCAGTGCTAATCACTGAGCCACCATGCCACCCTAACACAACGATATGTACAGTAATCAAAATAAGCCAATTTGTTTCAATGTCATGTACTTACTTAAGCAATGAAAATGTTGGCATTTCAACAGTTTTGATCAATTAAAGATGTGTATCTTGTTTAACTTCAGGTGACTTTCCATGAGAAAGACAGCATTTCGGCTTCAAGGGGG
G/T
AGTCTGCCGCTGGTCAAGAAGTCAGACAGATGGTCCAGACAACAGTGGTACATGGAGAACAGTTGGAAAAGCATGAGGGGAATCCATTCCTTGCCAGAGACTTGCCCTCTGCTCGGGATGACTTCACCCAGGTGAGCTGCCAAACACAGCAGCTGTTACTTACGGCTTTACTACAAAGTTGTTGGAAGATTTGTAGTTATTTAGGGAGAATCCGGCTGCAATTATGTTTTTTTAAATAAACCAAAAAGTTGGCTTATGTTATGTTATGTAATCAGCAAACTGTGATAGGGATAACATTTTTTAGATGTTATGATGTTCCATATGTGAGATTTGATCAAACTATTAAAAATAAAATATTACAGCATTCTGTCTTAGAAATAGACAGTGATTTTCCTTTTTTTTTGTTTTAATATTAGATACTATTACAAAGTAGGAATATGAATTACTATAAATTAAGTATAATATTAATATATCATTTATATGATTTAAGTAGTACTATG
(1)
OTHER sa19449 PAGES
ZMP:sa19449 (1)
GENOTYPES No data available

CITATIONS  (1)