ZFIN ID: ZDB-ALT-130221-1
Genomic Feature: zf359
Synonyms: ca1 (1)
Affected Genomic Regions: flr (1)
Type: Point Mutation (1)
Protocol:
Lab Of Origin:
Location: Chr 3: 28835791 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
FLANKING SEQUENCE (GENOMIC)
TTTGCTGGAATCTTTGGTTTTGCTTCTCCAGACACTGGTTGAGCAGTTGCCTCAGGAAGATCCAGACTATGATGTGGATCTCGGCTGTTTGCTTTATAAGGAAGGCGAGTTTGAAGAGGCCTGCAAAAAGTTTATGTCCTCCATGAATGTACTAGGCTACCAGCCAGGTGAGCTTCTTTACTTGTGCTGATTTATAACTGTGTGTGTTTGTGGTGTCTACATGCTAATGCTTAATAGACAAAACACGCAAAAACATATACACACACTGGTGTCTCATAGTAACTGGTTAGCCAAGAGTAACAAACATAACATTGACTGGCTGACCACACCGCGTAAGGGTAGTAATTTTACATTTTTATGGAAATGAATGCAATATGGGGAGCTTTTGACACACTGACGTTTTATAAAAGTAGCTGTTGTAATGTTGAACTAATTAAATGTTGTTGTTTTTTTTCTTGTTACAGATCTGGCATACAATATAGCGCTTTGTTACTACAGTT
T/G
AAAACAGTATGCCTCAGCGCTCAAATATATTGCTGAAATTATTGAACGTGGAATTAGAGAGCATCCGGGTATGTGTGACAGAAAATCCTTTACTGTAGGTGTTGCAAAATGCTAAACAGTGAGTTTCTAAGACCGATTTTATGTCTTTAGAACTGAGTATTGGAATGACGACAGAAGGCATTGATGTAAGGAGTGTCGGCAACACCCTCATCCTGCACGAGACTGCTTTGATTGAAGCCTTTAATCTGAAAGCAGCTATTGAATACCAGCTAAAGAACTGTAAGTATAGATAAAGTGTCTGGCCTGAGGTTTCATGTAGGCGCCTTCCTATTATATACTTGGTTATTTGTGCTGTTTATTCATAGTGTATATAATAAAACAGGTTCATAAGAAGAGTCTGTGGCCTTCGAGGATTCGTTTATGCATTTGATTTAAATGCAACTTCTCATTTAATCATCCGTTCACCTTCATGTTGTTTCATACCATTGAGAAATTTGCTC
OTHER zf359 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous flrzf359/zf359 flr ♀+/- ♂+/-
Unknown flrzf359 flr Unknown

CITATIONS  (4)