ZFIN ID: ZDB-ALT-120910-8
Genomic Feature: sa3119
Synonyms:
Affected Genomic Regions: amot (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 37539073 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCTCAATCTGATTTGCTCCTCTTCATGTTTCAGGTGTTCTGCTGGGTCCA
G/T
AGTTCCGTGGAGACTCTCTGAGAACAGAGTCCATTTCCTCTTCTCCATCT
(1)
OTHER sa3119 PAGES
ZMP:sa3119 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous amotsa3119/sa3119 (TL) amot ♀+/- ♂+/-

CITATIONS  (2)