ZFIN ID: ZDB-ALT-120910-4
Genomic Feature: sa2301
Synonyms:
Affected Genomic Regions: myh9a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 7752579 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAGCCTGCAGCTCTGCGATCTGATCATGCAGCTCTGTAGAGTCGCCCTCC
A/T
ACTTCCTCCTGTTCTTCTCCAACTCCTGCCTCATTTTCTCTTCCTTTCTT
(1)
OTHER sa2301 PAGES
ZMP:sa2301 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous myh9asa2301/sa2301 (TL) myh9a ♀+/- ♂+/-

CITATIONS  (2)