ZFIN ID: ZDB-ALT-120727-244
Genomic Feature: hu7894
Synonyms:
Affected Genomic Regions: ifnphi1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Cuppen Lab
Location: Chr 3: 22362873 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATTTATTTATTTTTTGGTCATTATATCAGATCATATCATCTGTTACACTC
C>T
AGGATTGACCCTTGCGTTGCTTGCGATGATGTCCATCCTCTGAAGGTGGC
(1)
OTHER hu7894 PAGES
ZMP:hu7894 (1)
GENOTYPESNo data available

CITATIONS  (1)