ZFIN ID: ZDB-ALT-120727-238
Genomic Feature: hu7857
Synonyms:
Affected Genomic Regions: bbx (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Cuppen Lab
Location: Chr 10: 28492777 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGCACACTGGGAAATCAGCCCTTTTCCAGCTGGCTGAGGTGAGATTACCT
A>T
AAAAACTTGTCTGTCAGACCCATAAAACCCTACTTAGCGCTGAGACGTCT
(1)
OTHER hu7857 PAGES
ZMP:hu7857 (1)
GENOTYPESNo data available

CITATIONS  (1)