header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-69
Genomic Feature: sa1271
Synonyms:
Affected Genomic Regions: atad1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 17439771 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGGTTGATGCTATCGATCCAACAAGAAAACAAAAGGTTGAGGCACAAAAA
C/T
AGGTAAGGTGTTTGATTTCAGCATCAGTTGTGTACATGAGTGTGCCTTTA
(1)
OTHER sa1271 PAGES
ZMP:sa1271 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous atad1bsa1271/sa1271 (TL) atad1b ♀+/- ♂+/-

CITATIONS  (3)