header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-433
Genomic Feature: sa618
Synonyms:
Affected Genomic Regions: huwe1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 28497742 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG
T/C
GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT
(1)
OTHER sa618 PAGES
ZMP:sa618 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous huwe1sa618/sa618 (TL) huwe1 ♀+/- ♂+/-

CITATIONS  (3)