header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-238
Genomic Feature: sa1663
Synonyms:
Affected Genomic Regions: amot (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 37514469 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GTCACGAGATCTGGAAATGAGGGCAGCAGCCTCAGTTTCCGAGGACACAT
C/A
GGCTAACAACAGCGGTGGGAGTGGACACACGGTTCTGCAGCGGCTCTTGC
(1)
OTHER sa1663 PAGES
ZMP:sa1663 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous amotsa1663/sa1663 (TL) amot ♀+/- ♂+/-

CITATIONS  (3)