ZFIN ID: ZDB-ALT-120411-134
Genomic Feature: sa1375
Synonyms:
Affected Genomic Regions: kctd16a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 23812488 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GGTAAATTGTTCTCCTCTAAAAAAGACATTTCTAACGACCTCACGCAGGACATCAAGGGACGCTACTTCATCGACCGGGACGGATTTCTCTTTAGGTACGTGCTGGACTATCTCCGCGATAAGACTGTCGTCCTGCCGGATTATTTTCCGGAGAAGGGGAGGCTGAAACGCGAAGCTGAGTTTTTCCAGCTGCCCGAGCTCGTCAAAATCCTAACCCCAGATGATTATAGTCACAGTGATTTTGACGAAGCATCCCAGGGAAGCGACCAGAGGTTATATCCAGCCTCTTACCTGGACGCGCGCGACCGACGCTACGGCTTCATCACGGTCGGGTACAAGAGCTCGTGCGCATTCGGGAGGGACACTGATCCCAAAGCCCGCGGAATACCCAAAATCTTCATTTGCGGAAGAGTCGGTCTGGCGAAAGAAGTTTTCGGCGACGCACTAAACGAGAGCCGGGATCCTGACAGACCGCCGGAGCGTTACACTTCTCAGTTTTA
C/A
CTGAAGTTTCGCCACCTGGAGCGAGCGTTTGATATGCTCGCGGAGAGCGGGTTCCACATCGTCGCGTGCAATTCATCACTCACCACATCTCCCCACAACAGGCATGCTGATGATAGATACTGGTCCAACAACACAGAGTACGTCTTCTATCGTAAGTACAGCTTATTTACTCTTTACGTTGTATTACAAAAAGAAAGAAAATAAAGCCATTTGGCAATGCTGGGTAGTTACTGATCAGATGAGATGTAATCTGGATTACGTAATCAGATTACAAAATGGAGTACTCGTAGTTAGATTATATTGCTTCTTAATATGAACATAATCAGATTACAGTTACTTTTTATGAATTACATGATTACATAGAGCATTAGTAACCCAACAGCATCCCACTTTTTTCTCTTATCATTTTTTCTTTCTAGTATGTCTTTCTAGTATGACTTTATTAGTATGTGTACAATTTGACCTAAAATGAGCCTATTTAGTTTACATTTCCCTGTTTG
(1)
OTHER sa1375 PAGES
ZMP:sa1375 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous kctd16asa1375/sa1375 (TL) kctd16a ♀+/- ♂+/-

CITATIONS  (3)