ZFIN ID: ZDB-ALT-080229-1
Genomic Feature: hu2041
Synonyms:
Affected Genomic Regions: myf6 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 4: 21718044 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTCCAGGCGCACTGCGAGGGTCAGTGCCTCATGTGGGCTTGCAAGATCTG
T/A
AAACGGAAATCTGCTCCTACTGACCGGCGAAAGGCCGCCACTTTGAGAGA
(1)
NOTES
Comment Citation
Hinits et al. (2009. Development 136:403-414) report that sequencing the  ... Hinits et al., 2009
OTHER hu2041 PAGES
ZMP:hu2041 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous myf6hu2041/hu2041 myf6 ♀+/- ♂+/-
Unknown myf6hu2041 myf6 Unknown

CITATIONS  (7)